Help and documentation
Use this report to see how well each primer matches the uploaded sequences. It is a screening tool: it helps you decide what to inspect, but it does not decide whether an assay has failed.
FASTA headers
Start each record with > and a unique sequence ID. Put the nucleotide sequence on the following line or lines.
>sample_001 optional description
ACGTTGCAAGCTTAGCGATCGATGCTAGCANNNNNTGGCATCGTACGATGCACTAGCATGCTACG
>sample_002
ACGTTGCAAGCTTAGCGATCGATGCTAGCANNNNNTGGCATCGTACGATGCACTAGCATGCTACG
- Only the first word after > is the ID: >sample_001 optional description becomes sample_001. Descriptions after a space are ignored.
- IDs must be unique within each file and at most 200 characters. Keep the full header within 1,000 characters. Avoid reserved prefixes gi|, lcl|, ref|, and gb|.
- Use nucleotide IUPAC letters (for example A, C, G, T, N, R, Y), with no spaces or gaps inside sequence lines. Every header needs a sequence. FASTQ is not supported.
Synthetic formatting examples only. Replace the IDs and sequences with your own data.
Primer database format
Start from a template below, or use Build a database to create the JSON without editing it by hand. Download the file, replace the example primers, then choose Upload a database.
Enter every primer as the oligo sequence in 5′ → 3′ direction, including reverse primers. Do not reverse-complement it before entry. The forward/reverse role is metadata; the analysis searches both strands of the uploaded sequence.
{
"schema_version": "1.0",
"database_version": "1.0",
"schemes": [
{
"scheme_id": "example-pcr",
"display_name": "Example PCR assay",
"organism": "Example-virus",
"version": "1.0",
"assay_type": "pcr",
"primers": [
{
"id": "Example_F",
"name": "Example_F",
"sequence": "ACGTTGCAAGCTTAGCGATCGATGCTAGCA",
"role": "forward",
"segment": ""
},
{
"id": "Example_R",
"name": "Example_R",
"sequence": "TGGCATCGTACGATGCACTAGCATGCTACG",
"role": "reverse",
"segment": ""
}
]
}
]
}
Synthetic primers for showing the format, not a validated assay. Replace the organism, names, and sequences before using your own data.
schema_version·database_version- Keep schema_version as "1.0". Set database_version to your own version label.
schemes[]- Each scheme needs scheme_id, display_name, organism, version, and primers. Give every scheme a unique scheme_id. Use assay_type: pcr or ngs (pcr is the default). Add another scheme object to include another assay or organism.
primers[]- Each primer needs id, name, sequence, role, and segment. IDs and names must be distinct within a scheme. Write both forward and reverse primer sequences as ordered, 5′ → 3′, using IUPAC nucleotide letters. Use role values such as forward, reverse, or probe; use an empty segment for non-influenza primers.
segment·subtype_tags- For influenza, specify the type in organism (for example "Influenza-A", "Influenza-B", "Influenza-C", or "Influenza-D"). Segment labels come from your database, for example "PB2", "PB1", "PA", "HA", "NP", "NA", "M", or "NS", and must match the FASTA headers. subtype_tags accepts labels such as ["H5N1", "H7N9"]. A selected tag matches exactly: "H5" does not automatically include "H5N1". List both tags to include a primer in both selections. An explicit empty list [] makes a primer shared by all subtypes of its influenza type; omitted tags can be inferred from legacy primer names. The subtype menu shows only types and tags present in the database; a type such as A selects all its primers, while other types use labels such as B/VICTORIA.
pool·strand- Optional: pool labels multiplex groups; strand may be "+", "-", or "". Upload inline primer sequences; files referring to external BED or FASTA assets require the CLI.
Save as UTF-8 JSON with double quotes and no comments or trailing commas. Maximum 250 kB, 500 primers, and 200 bases per primer. The upload check validates your file before it can be used.
How the values are calculated
The website and CLI use the same Python analysis engine. Your selected database, virus, subtype, assay type, and scheme determine which primers are tested. Influenza primers with a segment label are reported only against matching segment labels in FASTA headers, such as 01-HA|sample.
- Enter all primer sequences as the oligo in 5′ → 3′ direction, including reverse primers; do not reverse-complement them before entry. Each selected primer is searched against both strands of every relevant FASTA sequence using BLASTn. The forward/reverse role does not force a strand: the hit orientation depends on how the uploaded sequence is oriented.
- For each primer-sequence pair, the alignment with the fewest recalculated mismatches is kept; the higher BLAST bit score breaks a tie. If BLAST returns no usable alignment, the comparison is marked no_hit internally and shown as No hit.
- A local BLAST hit is extended to the full primer using adjacent sequence bases, reverse-complemented when needed. Alignment gaps are preserved. Mismatches are then recalculated, counting each incompatible base or gap column. Omitted ends are not automatically mismatches when compatible adjacent bases can be recovered from the sequence.
- Compatible IUPAC ambiguity codes are treated as matches. For example, primer base Y is compatible with C or T in the sequence.
- Mismatch positions start at 1 at the primer’s 5′ end, on either strand. Base changes use position:primer base>sequence base, for example 9:T>A. Insertions are anchored to the preceding primer position (position 1 for a leading insertion): 9:->AC means AC inserted after position 9. They do not shift later primer positions. Each gap base counts as one difference, but each anchor appears once in position charts; multiple changes at the same anchor are combined. The final five primer bases remain the 3′ terminal region for reverse primers too.
For a hit, mismatch count is recalculated using a full-primer alignment. Local BLAST hits are extended with adjacent sequence bases where available; incompatible bases and missing bases represented by gaps count as mismatches. Reported identity is 100 × (primer length − mismatch count) / primer length.
20 primer bases, 2 mismatches → 90% identityBLASTn uses reward 2, penalty −3, word size 4, and DUST filtering. A no-hit result means BLAST did not return a usable alignment under these search settings; the web interface does not add a percentage-identity cutoff. The provenance download records the actual BLAST version and parameters.
Key terms
- Hit: an accepted alignment was found between the primer and the sequence.
- No hit: no alignment passed the current matching criteria.
- Mismatch: a base in the observed sequence does not match the compatible base or IUPAC code in the primer.
- Identity: for hit comparisons, 100 × (primer length − recalculated mismatch count) / primer length. This is recalculated by Primer Checker, not the raw BLAST percentage identity.
- Terminal mismatch rule: for primers, only the last five bases at the 3' end are counted; for probes, only the first five bases at the 5' end are counted.
Website results
Start with the summary cards, then use By primer and By sample to examine individual comparisons. Click a primer to narrow the sample table and choose Inspect to see its alignment.
- Summary cards
- The top cards describe the complete analysis and stay unchanged when table filters are applied. Files and sequence records count the uploaded inputs. Each combination of filename and sequence ID is counted separately. Successful hits exclude no-hit comparisons. Hits with mismatches counts hit comparisons with at least one mismatch.
- By primer
- Tested is the number of visible primer/sequence comparisons. Perfect means a hit with zero mismatches. Mismatches counts hits with at least one mismatch; No hit is separate. Max. mismatches is the highest mismatch count among hits. Affected is 100 × hits with mismatches / all tested comparisons, including no-hit comparisons in the denominator. Primers from different assays are kept separate.
- By sample
- Each row is one primer checked against one relevant sequence. Identity and mismatch counts are shown only for hits. Positions are numbered from the primer’s 5′ end. A change such as 9:T>A means primer base T corresponds to sequence base A at position 9.
- Filters and downloads
- Website filters change the tables and their row counts. CSV, HTML, and provenance downloads contain the complete analysis, not only the currently filtered table. The HTML report has its own filters, charts, and automatic review levels.
- Alignment
- The inspector shows the primer above the observed sequence, with mismatches highlighted and positions relative to the primer. Forward or reverse describes the subject alignment orientation. No-hit comparisons have no alignment and must not be read as zero mismatches.
The website tables show descriptive counts. The Low, Watch, High, and Critical review levels described below appear in the downloaded HTML report.
Downloaded HTML report
Download HTML report to open a self-contained report in your browser. It includes its own English/Norsk switch and Help and documentation tab. The guidance below uses the same text files as that report.
Recommended review workflow
- Choose an organism or virus, primer or FASTA file if you want to limit the report. Leave the filters at All to review the complete data set.
- Start in the Primer overview. Review primers marked Watch, High or Critical before primers marked Low.
- Click the primer name. Check the no-hit rate, highest mismatch count and the proportion of hits with 2+ or 3+ mismatches.
- Use the mismatch-position chart to see whether the same positions are affected in many sequences, especially near the primer ends.
- Check individual no-hit sequences and sequences with several mismatches. Open the alignment when it is available.
- Before changing a primer or assay, assess the finding together with sequence quality, assay validation, Ct trends, controls, epidemiology and other laboratory information.
Summary cards and filters
Filters update all visible cards, tables and charts. The review level is recalculated after the organism/virus, primer and FASTA filters are applied.
- Comparisons: the number of primer-sequence comparisons left after filtering.
- Primers: the number of unique primer names in the filtered data.
- Sequences: the number of unique FASTA sequence IDs in the filtered data.
- Hits and No hits: the numbers of accepted and unaccepted alignments.
- Mean identity (%): the mean identity of hit comparisons only. No-hit comparisons are excluded because they have no accepted alignment.
Primer overview columns
The table summarizes the current filtered data for each primer. Select a column heading to sort the table.
- Review level: the highest automatic level reached by the primer under the current filters.
- Comparisons, Hits and No hits: the total number of comparisons and their match status.
- No-hit rate: no-hit comparisons divided by all comparisons for the primer.
- Highest mismatch count: the largest full-primer mismatch count among hit comparisons.
- Mean identity (%): the mean percentage identity among hit comparisons.
- Hits with 2+ or 3+ mismatches: the percentage of hit comparisons with at least two or at least three mismatches.
- Terminal-region mismatch share: the percentage of hit comparisons with at least one mismatch in the role-specific terminal region: the primer 3' end or probe 5' end.
Primer details
Each primer panel combines the summary values, hit rate, mismatch-position chart, mismatch-count distribution and sequence table. Use these parts together: a percentage is easier to interpret when you also know the number of comparisons behind it.
Mismatch-position chart
Each bar represents one primer or probe position. Its height is the percentage of hit comparisons with a mismatch at that position. Colors show the base found in the sequence. The y-axis is adjusted to the data in each chart, so check the axis before comparing charts. Red marks show the role-specific terminal region: the last five bases at the 3' end for primers, or the first five bases at the 5' end for probes.
Mismatch-count distribution
This chart groups comparisons into 0, 1, 2, 3 or 4+ mismatches. No-hit comparisons have a separate category. Counts and percentages use all filtered comparisons for that primer.
Sequence table and alignment
The table shows the FASTA file, organism or virus, sequence ID, segment, match status, identity, mismatch count, mismatch positions and base changes. No-hit comparisons are shown first by default. Select a sequence ID to open the primer-sequence alignment when alignment strings are available.
How to read an alignment
The primer is shown above the observed sequence, both in the primer’s 5′ → 3′ direction. Reverse-strand subject hits are reverse-complemented, so position 1 stays at the primer’s 5′ end and the 3′ end stays on the right. This is an orientation-normalized comparison, not a drawing of the two physical DNA strands. A vertical line marks a compatible base; a space or gap marks a difference. Subject coordinates are 1-based, inclusive endpoints of the original local BLAST hit, before extension to the full primer; they decrease for reverse-strand hits.
NGS amplicon overview
This section appears only for NGS panels with recognized LEFT and RIGHT primer names. Alternative primers are treated as backup. A side is available when it has at least one primer at Low or Watch level. If no such LEFT or RIGHT primer remains, the amplicon is marked Critical in this overview. This is a screening rule, not a direct measurement of amplicon performance.
Automatic review levels
The level is calculated separately for each primer from the filtered comparisons. If several rules apply, the highest level is shown. The thresholds prioritize review; they are not validated assay-failure limits.
- Critical: no-hit rate is at least 20%, hits with 3+ mismatches are at least 25%, or hits with a role-specific terminal mismatch are at least 50%.
- High: no-hit rate is at least 5%, hits with 2+ mismatches are at least 30%, or hits with a role-specific terminal mismatch are at least 5%.
- Watch: at least one no-hit comparison is present, or the highest mismatch count is at least 2.
- Low: none of the Watch, High or Critical rules are met.
It is the percentage of hit comparisons with at least one mismatch in the selected terminal region. For primers, this is the last five bases at the 3' end; for probes, it is the first five bases at the 5' end.
No. These levels are automatic review signals. Interpret them together with assay validation, Ct trends, control results, epidemiology and laboratory context.
Common questions
Which results should I check first?
Start with primers marked Watch, High or Critical. Open their details and check which sequences, mismatch counts and primer positions caused the level.
What does one comparison mean?
One comparison is one primer checked against one relevant sequence from the FASTA input. A sequence may therefore appear once for each primer that was tested against it.
What does No hit mean?
No hit means that no alignment between the primer and sequence passed the current matching criteria. Possible reasons include true sequence differences, a partial or low-quality sequence, missing sequence at the binding site or unsuitable input. It is not by itself proof of assay failure.
What do identity and mismatch count mean?
For a hit, mismatch count is recalculated using a full-primer alignment. Local BLAST hits are extended with adjacent sequence bases where available; incompatible bases and missing bases represented by gaps count as mismatches. Reported identity is 100 × (primer length − mismatch count) / primer length.
What does mismatch in the selected terminal region mean?
It is the percentage of hit comparisons with at least one mismatch in the selected terminal region. For primers, this is the last five bases at the 3' end; for probes, it is the first five bases at the 5' end.
Does High or Critical mean that the assay has failed?
No. These levels are automatic review signals. Interpret them together with assay validation, Ct trends, control results, epidemiology and laboratory context.
Why can the review level change when I use a filter?
The level is recalculated from the comparisons left after filtering. A primer can therefore have a different level in a selected subset than in the full data set.
Important limitations
- The report only assesses the sequences included in the current input. It may not represent all circulating variants or all samples tested in the laboratory.
- A partial, low-quality or incorrectly labelled sequence can produce mismatches or a no-hit result.
- The review rules simplify primer performance. They do not model every effect of mismatch position, chemistry, primer concentration, probe performance or assay conditions.
- A Low level does not guarantee assay performance, and a High or Critical level does not prove assay failure.
- Confirm important findings with appropriate laboratory data and, when needed, manual sequence review or experimental testing.
Uploads and reproducibility
The bundled dummy database contains invented sequences for software testing only. Use the synthetic FASTA example to try it. For your own analysis, upload a self-contained JSON library or build and download your own database. The preflight check validates file sizes and workload before Analyze is enabled; the server repeats those checks during analysis. Large workloads should use the CLI.
Uploads are processed temporarily. Download your custom database and the CSV, HTML, and provenance JSON to retain a reproducible record. Provenance includes database and input fingerprints, selections, time, application version, and BLAST settings. Language selection changes presentation only; primer names, sequences, calculations, and CSV column names remain unchanged.