Primer Checker/Sequence compatibility
CONSENSUS SEQUENCE ANALYSIS

Every base.In focus.

Evaluate PCR and sequencing primer compatibility against viral consensus sequences.

New analysis

Your sequences. Your primers. A closer look.

PRIMER DATABASEConnecting…Choose a valid database
1Upload sequences2Configure analysis3Explore results

Primer database

Try dummy data or bring your own primers

View primer database format and download templates

Start from a template below, or use Build a database to create the JSON without editing it by hand. Download the file, replace the example primers, then choose Upload a database.

Enter every primer as the oligo sequence in 5′ → 3′ direction, including reverse primers. Do not reverse-complement it before entry. The forward/reverse role is metadata; the analysis searches both strands of the uploaded sequence.

{
  "schema_version": "1.0",
  "database_version": "1.0",
  "schemes": [
    {
      "scheme_id": "example-pcr",
      "display_name": "Example PCR assay",
      "organism": "Example-virus",
      "version": "1.0",
      "assay_type": "pcr",
      "primers": [
        {
          "id": "Example_F",
          "name": "Example_F",
          "sequence": "ACGTTGCAAGCTTAGCGATCGATGCTAGCA",
          "role": "forward",
          "segment": ""
        },
        {
          "id": "Example_R",
          "name": "Example_R",
          "sequence": "TGGCATCGTACGATGCACTAGCATGCTACG",
          "role": "reverse",
          "segment": ""
        }
      ]
    }
  ]
}

Synthetic primers for showing the format, not a validated assay. Replace the organism, names, and sequences before using your own data.

schema_version · database_version
Keep schema_version as "1.0". Set database_version to your own version label.
schemes[]
Each scheme needs scheme_id, display_name, organism, version, and primers. Give every scheme a unique scheme_id. Use assay_type: pcr or ngs (pcr is the default). Add another scheme object to include another assay or organism.
primers[]
Each primer needs id, name, sequence, role, and segment. IDs and names must be distinct within a scheme. Write both forward and reverse primer sequences as ordered, 5′ → 3′, using IUPAC nucleotide letters. Use role values such as forward, reverse, or probe; use an empty segment for non-influenza primers.
segment · subtype_tags
For influenza, specify the type in organism (for example "Influenza-A", "Influenza-B", "Influenza-C", or "Influenza-D"). Segment labels come from your database, for example "PB2", "PB1", "PA", "HA", "NP", "NA", "M", or "NS", and must match the FASTA headers. subtype_tags accepts labels such as ["H5N1", "H7N9"]. A selected tag matches exactly: "H5" does not automatically include "H5N1". List both tags to include a primer in both selections. An explicit empty list [] makes a primer shared by all subtypes of its influenza type; omitted tags can be inferred from legacy primer names. The subtype menu shows only types and tags present in the database; a type such as A selects all its primers, while other types use labels such as B/VICTORIA.
pool · strand
Optional: pool labels multiplex groups; strand may be "+", "-", or "". Upload inline primer sequences; files referring to external BED or FASTA assets require the CLI.

Save as UTF-8 JSON with double quotes and no comments or trailing commas. Maximum 250 kB, 500 primers, and 200 bases per primer. The upload check validates your file before it can be used.

Database version: loading…

Sequence files

One or more consensus sequences in FASTA format

REQUIRED

Drop your FASTA files here

or browse files from your computer

.fasta, .fa, .fna, .fas·Up to 10 files, 3 MB combined
Just exploring?

Header example: >sample_001 · Influenza: >01-HA|sample_001

FASTA header rules and examples

Start each record with > and a unique sequence ID. Put the nucleotide sequence on the following line or lines.

>sample_001 optional description
ACGTTGCAAGCTTAGCGATCGATGCTAGCANNNNNTGGCATCGTACGATGCACTAGCATGCTACG
>sample_002
ACGTTGCAAGCTTAGCGATCGATGCTAGCANNNNNTGGCATCGTACGATGCACTAGCATGCTACG
  • Only the first word after > is the ID: >sample_001 optional description becomes sample_001. Descriptions after a space are ignored.
  • IDs must be unique within each file and at most 200 characters. Keep the full header within 1,000 characters. Avoid reserved prefixes gi|, lcl|, ref|, and gb|.
  • Use nucleotide IUPAC letters (for example A, C, G, T, N, R, Y), with no spaces or gaps inside sequence lines. Every header needs a sequence. FASTQ is not supported.

Synthetic formatting examples only. Replace the IDs and sequences with your own data.

Analysis settings

Select the primers to evaluate

Assay type

Sequences are compared with the selected primer database using BLASTn and IUPAC-aware mismatch matching.

Shared with the command-line analysis engine
Check before analysis

Maximum 3 MB total, including the database · 10 files · 200 records · 2,000 comparisons · 300 BLAST searches · 50 million bases × primers.

Create or select a valid primer database to check your batch.

Do not upload confidential, identifiable, or otherwise restricted data to this public deployment.Uploads are processed temporarily and removed after analysis.

0 files selected · 0 kB
01

Compare every primer

Review matches and mismatch patterns across your selected sequences.

02

Inspect the alignment

Explore individual bases, substitutions, and primer mismatch positions.

03

Keep a reproducible record

Download CSV results, a standalone HTML report, and analysis provenance.